View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5235_high_9 (Length: 326)
Name: NF5235_high_9
Description: NF5235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5235_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 51112655 - 51112971
Alignment:
| Q |
1 |
tcatcatctgcatagctttcgtcagcagcataatgtttggtcttttcagaagcatcagtggcataatctctgattttcttagaagcatcccaagcatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112655 |
tcatcatctgcatagctttcgtcagcagcataatgtttggtcttctcagaagcatcagtggcataatctctgattttcttagaagcatcccaagcatagc |
51112754 |
T |
 |
| Q |
101 |
ctttggttttctcagcagcatcatgggcatggtcactggctttttgagcagtttccttggacttgtgtgcagtttcatctgcatagtgtttggttttgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112755 |
ctttggttttctcagcagcatcatgggcatggtcactggctttttgagcagtttccttggacttgtgtgcagtttcatctgcatagtgtttggttttgtg |
51112854 |
T |
 |
| Q |
201 |
tgcagcgtctgaagcatattcagaggctttatcagtggtggtgctgtccttatctttgtctttgaagccaaggccttcggtgattttctctttggcccac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112855 |
tgcagcgtctgaagcatattcagaggctttatcagtggtggtgctgtccttatctttgtctttgaagccaaggccttcggtgattttctctttggcccac |
51112954 |
T |
 |
| Q |
301 |
tcagtccatgtctctgc |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
51112955 |
tcagtccatgtctctgc |
51112971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University