View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5236-Insertion-3 (Length: 326)

Name: NF5236-Insertion-3
Description: NF5236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5236-Insertion-3
NF5236-Insertion-3
[»] chr1 (3 HSPs)
chr1 (7-102)||(38315987-38316082)
chr1 (237-326)||(38315762-38315851)
chr1 (184-213)||(38315876-38315905)
[»] scaffold0016 (1 HSPs)
scaffold0016 (285-326)||(45103-45144)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 5e-47; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 7 - 102
Target Start/End: Complemental strand, 38316082 - 38315987
Alignment:
7 actcttctctcaacatgattttcaattttttcatcttcgagttcagattaaacttcaattgttgagctgagattacgtttattttagttccgatta 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38316082 actcttctctcaacatgattttcaattttttcatcttcgagttcagattaaacttcaattgttgagctgagattacgtttattttagttccgatta 38315987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 237 - 326
Target Start/End: Complemental strand, 38315851 - 38315762
Alignment:
237 gttattcccttcaaatgattttgcatgatttttattttcttaagttttgaggttgttatttgcatcttgctttcaaacggtggatttgtt 326  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38315851 gttattcccttcaaatgattttgcatgatttttattttcttaagttttgaggttgttatttgcatcttgctttcaaacggtggatttgtt 38315762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 213
Target Start/End: Complemental strand, 38315905 - 38315876
Alignment:
184 gtagtttgtttcgagtgttattcagcttaa 213  Q
    ||||||||||||||||||||||||||||||    
38315905 gtagtttgtttcgagtgttattcagcttaa 38315876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 285 - 326
Target Start/End: Complemental strand, 45144 - 45103
Alignment:
285 gaggttgttatttgcatcttgctttcaaacggtggatttgtt 326  Q
    ||||||||||||  ||| ||||||||||||||||||||||||    
45144 gaggttgttattcacattttgctttcaaacggtggatttgtt 45103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University