View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5236-Insertion-7 (Length: 49)
Name: NF5236-Insertion-7
Description: NF5236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5236-Insertion-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.00000000001; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 10 - 44
Target Start/End: Complemental strand, 28605344 - 28605310
Alignment:
| Q |
10 |
tcacatacttgaagtttctcatcccaaaacttctc |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28605344 |
tcacatacttgaagtttctcatcccaaaacttctc |
28605310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.00000000005
Query Start/End: Original strand, 9 - 46
Target Start/End: Complemental strand, 28635513 - 28635476
Alignment:
| Q |
9 |
ttcacatacttgaagtttctcatcccaaaacttctcac |
46 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28635513 |
ttcacatacttgaaatttctcatcccaaaacttctcac |
28635476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.0000000008
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 28654795 - 28654760
Alignment:
| Q |
8 |
gttcacatacttgaagtttctcatcccaaaacttct |
43 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28654795 |
gttcacatacttgaaatttctcatcccaaaacttct |
28654760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University