View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5237_high_3 (Length: 207)
Name: NF5237_high_3
Description: NF5237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5237_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 14135323 - 14135224
Alignment:
| Q |
1 |
aatgccaaagataagtatcagagtaatttgagagattccatgagaaccaagcattggtgcccaagctaaagaatttgtaccaaatatcattttgaaggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14135323 |
aatgccaaagataagtatcagagtaatttgagagattccatgagaaccaagcattggtgcccaagctaaagaatttgtaccaaatatcatttttaaggaa |
14135224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 97 - 169
Target Start/End: Complemental strand, 14135151 - 14135079
Alignment:
| Q |
97 |
ggaatcttgagacatacatcggttttgtcttttgaagtttgtgagaagagtaacatgagcaattttacaaaga |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14135151 |
ggaatcttgagacatacatcggttatgtcttttgaagtttgtgagaagagtaacatgagcaattttacaaaga |
14135079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University