View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5238_low_2 (Length: 358)
Name: NF5238_low_2
Description: NF5238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5238_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 203 - 323
Target Start/End: Original strand, 31141163 - 31141284
Alignment:
| Q |
203 |
taaaattaagaattaaatccacgtttaatcttgcaca---tattatatgactactctttgttgctaatgttaatttcaattatatagaaggtattttctc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31141163 |
taaaattaagaattaaatccacgtttaatcttgcaaatattattatatgactaccttttgttgctaatgttaatttcaat--tatagaaggtgttttctc |
31141260 |
T |
|
| Q |
300 |
acattttataactacaaaaccgac |
323 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31141261 |
acattttataactacaaaaccgac |
31141284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 54 - 117
Target Start/End: Original strand, 31141085 - 31141148
Alignment:
| Q |
54 |
aattgcttgtcgtcgcgtctctgttgagatgtaaccacaattcccaccttttgtgttgcaatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31141085 |
aattgcttgtcgtcgcgtctctgttgagatgtaaccacaattcccaccttttgtgttgcaatct |
31141148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University