View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5238_low_3 (Length: 334)
Name: NF5238_low_3
Description: NF5238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5238_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 3e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 251 - 323
Target Start/End: Original strand, 7872302 - 7872374
Alignment:
| Q |
251 |
tatatttcactattgggtgacataagctgatatagaaagccgcaatatgatgaggttgtttgttttctttcat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7872302 |
tatatttcactattgggtgacataagctgatatagaaagccgcaatatgatgaggttgtttgttttctttcat |
7872374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 129 - 177
Target Start/End: Original strand, 7872179 - 7872227
Alignment:
| Q |
129 |
cttcgaaattattctattcttcaatgtgaactaaataccataacaagac |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7872179 |
cttcgaaattattctattcttcaatgtgaactgaataccataacaagac |
7872227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 7872070 - 7872107
Alignment:
| Q |
19 |
gacatgaaaattaatagtaaaaaactttgattctggtg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7872070 |
gacatgaaaattaatagtaaaaaactttgattctggtg |
7872107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University