View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5238_low_5 (Length: 258)
Name: NF5238_low_5
Description: NF5238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5238_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 34274736 - 34274954
Alignment:
| Q |
18 |
gtaacaagttgattttgaattggttgaatttacttgtgcattttggttcagaacaggaaactaaaaaggtgaagatggctaagcatgtcattaaggtgga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34274736 |
gtaacaagttgattttgaattggttgaatttacttgtgcattttggttcagaacaggaaactaaaaaggtgaagatggctaagcatgtcattaagttgga |
34274835 |
T |
|
| Q |
118 |
gtccgttcctgaggaacaaatcgacattacaagtgcagaagtcgttcctgatgcatctaacgaaattgaggaccctgatgcaactgagtattcaagttcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34274836 |
gtccgttcctgaggaacaaatcgacattacaagtgcagaagtcgttcctgatgcatctaacgaaattgaggaccctgatgcaactgagtattcaagttcg |
34274935 |
T |
|
| Q |
218 |
tttgctgataccatctctg |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34274936 |
tttgctgataccatctctg |
34274954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 185 - 228
Target Start/End: Original strand, 34281707 - 34281750
Alignment:
| Q |
185 |
gaggaccctgatgcaactgagtattcaagttcgtttgctgatac |
228 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
34281707 |
gaggaccctgatgcaactgaatattcgagttcctttgctgatac |
34281750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 101
Target Start/End: Complemental strand, 20229857 - 20229778
Alignment:
| Q |
22 |
caagttgattttgaattggttgaatttacttgtgcattttggttcagaacaggaaactaaaaaggtgaagatggctaagc |
101 |
Q |
| |
|
|||||| |||||||||| ||||||||| || || |||| | || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
20229857 |
caagttaattttgaattcattgaatttagttatgaatttagattttgaacaggtaactaaaaaggtgaagatggctaagc |
20229778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University