View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5239_low_2 (Length: 447)
Name: NF5239_low_2
Description: NF5239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5239_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 10 - 429
Target Start/End: Complemental strand, 40255174 - 40254755
Alignment:
| Q |
10 |
ataattctccttgttgatgctatgaagtgaaaggctagaggaagcaacatcatcaatatttgcatttactattccaaatttgttttgatgaannnnnnnn |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40255174 |
ataattctccttgttgatgctatgaagtgaaaggctagaggaagcaacatcatcaatatttgcatttactattccaaatttgttttgatgaattttttgc |
40255075 |
T |
|
| Q |
110 |
nnnnnnaaggccatgttgcatgattcaactattcttgtgttagatgaattcattgaggaaattttcttctcattatttgattggaggctagacaaagata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40255074 |
ttttttaaggccatgttgcatgattcaactattcttgtgttagatgaattcattgaggaaattttcttctcattatttgattggaggctagacaaagata |
40254975 |
T |
|
| Q |
210 |
aatcacatgaaagttgttgctttggatgatcaagttgtggaatagtactatatgtcttagcttgtgtagatggctgaaaatttcttattaacaattgaag |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40254974 |
aatcacatgaaagttgttgctttggatgatcaagttgtggaatagtactatatgtcttagcttgtgtagatggctgaaaatttcttattaacaattgaag |
40254875 |
T |
|
| Q |
310 |
ttgatctcttgcttcatctctttcttggcaagctctctgtaatagcttgtataaatgatcaacagtttcttcatatttctttatctcagcactggattcc |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40254874 |
ttgatctcttgcttcatctctttcttggcaagctctctgtaatagcttgtataaatgatcaacagtttcttcatatttctttatctcagcactggattcc |
40254775 |
T |
|
| Q |
410 |
atttttgtcgatattagttc |
429 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40254774 |
atttttgtcgatattagttc |
40254755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University