View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240-Insertion-4 (Length: 339)
Name: NF5240-Insertion-4
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240-Insertion-4 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 135 - 339
Target Start/End: Original strand, 46723177 - 46723381
Alignment:
| Q |
135 |
gcaatacaacagctaccattggtgtggaggttcatccactagacttttatacaaattgtggaaaaattcggtttgattgctgggacactgctggccaaga |
234 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46723177 |
gcaatacaacaactaccattggtgtggaggttcatccactagacttttatacaaattgtggaaaaattcggtttaattgctgggacactgctggccaagg |
46723276 |
T |
|
| Q |
235 |
aaaacttggtggtctcagagatgcttattagtaagttgtataccatctacatcttaatttcattatgtttctaactcccttactaatttagttattaatc |
334 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46723277 |
aaaatttggtggtctcagagatgcttattagtaagttttatactatctaaatcttaatttcattatgtttctaactcccttactaatttagttattaatc |
46723376 |
T |
|
| Q |
335 |
atata |
339 |
Q |
| |
|
||||| |
|
|
| T |
46723377 |
atata |
46723381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 136 - 200
Target Start/End: Complemental strand, 46626292 - 46626228
Alignment:
| Q |
136 |
caatacaacagctaccattggtgtggaggttcatccactagacttttatacaaattgtggaaaaa |
200 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
46626292 |
caatataacatctaccattggtgtggaggttcatctactagactttcattcaaattgtggaaaaa |
46626228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 270
Target Start/End: Complemental strand, 49686355 - 49686227
Alignment:
| Q |
142 |
aacagctaccattggtgtggaggttcatccactagacttttatacaaattgtggaaaaattcggtttgattgctgggacactgctggccaagaaaaactt |
241 |
Q |
| |
|
||||||||| ||||||||||| || |||||| | || || | ||||| || ||||| |||||||| | |||||||| |||||||| ||||| || || |
|
|
| T |
49686355 |
aacagctacaattggtgtggaagtgcatccattggatttcttcacaaactgcggaaagattcggttctactgctgggatactgctggacaagagaagttt |
49686256 |
T |
|
| Q |
242 |
ggtggtctcagagatgcttattagtaagt |
270 |
Q |
| |
|
||||| |||||||||| || |||||||| |
|
|
| T |
49686255 |
ggtggcctcagagatggatactagtaagt |
49686227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University