View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_high_14 (Length: 305)
Name: NF5240_high_14
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 15 - 287
Target Start/End: Complemental strand, 18133389 - 18133117
Alignment:
| Q |
15 |
gagagttaggttaaccatttgaagatctttggtgccagagattgaagagaatgtgtggggacgagttttgatatcgaagatgtaaggcttttgaacccat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133389 |
gagagttaggttaaccatttgaagatctttggtgccagagattgaagagaatgtgtggggacgagttttgatatcgaagatgtaaggcttttgaacccat |
18133290 |
T |
 |
| Q |
115 |
gggatgaggaaatgggttccttcaccgattgattggtcgaggattccgcgaaaacggtcgaagaggacggcgcgttggccaccatcgacggtgtagaggg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133289 |
gggatgaggaaatgggttccttcaccgattgattggtcgaggattccgcgaaaacggtcgaagaggacggcgcgttggccaccatcgacggtgtagaggg |
18133190 |
T |
 |
| Q |
215 |
aggtgttgacaacggttgcggcggtgccgaggccgaaagcggcacgggcgaggttggttaggaaggagactgc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133189 |
aggtgttgacaacggttgcggcggtgccgaggccgaaagcggcacgggcgaggttggttaggaaggagactgc |
18133117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 28 - 251
Target Start/End: Original strand, 1385107 - 1385330
Alignment:
| Q |
28 |
accatttgaagatctttggtgccagagattgaagagaatgtgtggggacgagttttgatatcgaagatgtaaggcttttgaacccatgggatgaggaaat |
127 |
Q |
| |
|
||||| |||||||||||||| || ||||| || ||||||||||| || ||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1385107 |
accatctgaagatctttggtaccggagatggatgagaatgtgtgaggtcgagtgcggatatcgaagacgtaaggcttttgaacccatgggatgaggaaat |
1385206 |
T |
 |
| Q |
128 |
gggttccttcaccgattgattggtcgaggattccgcgaaaacggtcgaagaggacggcgcgttggccaccatcgacggtgtagagggaggtgttgacaac |
227 |
Q |
| |
|
| ||||||||||||| ||||| | ||||| ||||| || | ||| ||||||||||||||||||||||| |||||||||||||| |||| |||||| | |
|
|
| T |
1385207 |
gagttccttcaccgactgattcggaaaggatgccgcggaatctgtcaaagaggacggcgcgttggccaccgtcgacggtgtagagagaggagttgacggc |
1385306 |
T |
 |
| Q |
228 |
ggttgcggcggtgccgaggccgaa |
251 |
Q |
| |
|
||||||||||| |||||| ||||| |
|
|
| T |
1385307 |
ggttgcggcggcgccgagaccgaa |
1385330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 91 - 140
Target Start/End: Complemental strand, 40614842 - 40614793
Alignment:
| Q |
91 |
aagatgtaaggcttttgaacccatgggatgaggaaatgggttccttcacc |
140 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
40614842 |
aagatgtagggcttttgaacccatgggatcaggaaatgagttccttcacc |
40614793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University