View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5240_high_14 (Length: 305)

Name: NF5240_high_14
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5240_high_14
NF5240_high_14
[»] chr8 (1 HSPs)
chr8 (15-287)||(18133117-18133389)
[»] chr3 (1 HSPs)
chr3 (28-251)||(1385107-1385330)
[»] chr5 (1 HSPs)
chr5 (91-140)||(40614793-40614842)


Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 15 - 287
Target Start/End: Complemental strand, 18133389 - 18133117
Alignment:
15 gagagttaggttaaccatttgaagatctttggtgccagagattgaagagaatgtgtggggacgagttttgatatcgaagatgtaaggcttttgaacccat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18133389 gagagttaggttaaccatttgaagatctttggtgccagagattgaagagaatgtgtggggacgagttttgatatcgaagatgtaaggcttttgaacccat 18133290  T
115 gggatgaggaaatgggttccttcaccgattgattggtcgaggattccgcgaaaacggtcgaagaggacggcgcgttggccaccatcgacggtgtagaggg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18133289 gggatgaggaaatgggttccttcaccgattgattggtcgaggattccgcgaaaacggtcgaagaggacggcgcgttggccaccatcgacggtgtagaggg 18133190  T
215 aggtgttgacaacggttgcggcggtgccgaggccgaaagcggcacgggcgaggttggttaggaaggagactgc 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18133189 aggtgttgacaacggttgcggcggtgccgaggccgaaagcggcacgggcgaggttggttaggaaggagactgc 18133117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 28 - 251
Target Start/End: Original strand, 1385107 - 1385330
Alignment:
28 accatttgaagatctttggtgccagagattgaagagaatgtgtggggacgagttttgatatcgaagatgtaaggcttttgaacccatgggatgaggaaat 127  Q
    ||||| |||||||||||||| || ||||| || ||||||||||| || |||||   ||||||||||| ||||||||||||||||||||||||||||||||    
1385107 accatctgaagatctttggtaccggagatggatgagaatgtgtgaggtcgagtgcggatatcgaagacgtaaggcttttgaacccatgggatgaggaaat 1385206  T
128 gggttccttcaccgattgattggtcgaggattccgcgaaaacggtcgaagaggacggcgcgttggccaccatcgacggtgtagagggaggtgttgacaac 227  Q
    | ||||||||||||| ||||| |   ||||| ||||| || | ||| ||||||||||||||||||||||| |||||||||||||| |||| ||||||  |    
1385207 gagttccttcaccgactgattcggaaaggatgccgcggaatctgtcaaagaggacggcgcgttggccaccgtcgacggtgtagagagaggagttgacggc 1385306  T
228 ggttgcggcggtgccgaggccgaa 251  Q
    ||||||||||| |||||| |||||    
1385307 ggttgcggcggcgccgagaccgaa 1385330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 91 - 140
Target Start/End: Complemental strand, 40614842 - 40614793
Alignment:
91 aagatgtaaggcttttgaacccatgggatgaggaaatgggttccttcacc 140  Q
    |||||||| |||||||||||||||||||| |||||||| |||||||||||    
40614842 aagatgtagggcttttgaacccatgggatcaggaaatgagttccttcacc 40614793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University