View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_high_21 (Length: 248)
Name: NF5240_high_21
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 84 - 233
Target Start/End: Complemental strand, 7141489 - 7141340
Alignment:
| Q |
84 |
cttaaatcagaatattgcagattttctaaaatgtttgtgaaataggaagtgatcagagaagcaacaaaaccttcacaaccttgaggagacttgaaatgag |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7141489 |
cttaaatcagaatattgcagattttctaaaatgtttgtgaaataggaagtgatcagagtagcaacaaaaccttcacaaccttgaggagacgtgaaatgag |
7141390 |
T |
 |
| Q |
184 |
agcaatgtctcctcactatctaccacgcctagatgtcatacgagtataat |
233 |
Q |
| |
|
|||||||||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
7141389 |
agcaatgtctccccattacctaccacgcctagatgtcatacgagtataat |
7141340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 85
Target Start/End: Complemental strand, 7142516 - 7142483
Alignment:
| Q |
52 |
aggatgtaggagaagagaactagtcttttgcact |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7142516 |
aggatgtaggagaagagaactagtcttttgcact |
7142483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University