View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_high_25 (Length: 236)
Name: NF5240_high_25
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 41 - 223
Target Start/End: Complemental strand, 3734405 - 3734223
Alignment:
| Q |
41 |
tgtaacaatatggcatcatacactattttaaaggttttaaaattaaactctaagtatgcatggaaaggaagagaagaagaatgatcagacaaattcctcg |
140 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3734405 |
tgtaacaatatggcatcatacactaatttaaaggttttaaaattaaactctaagtatgcatggaaaggaagagaagaagaatgatcagacaaattcctcg |
3734306 |
T |
 |
| Q |
141 |
gtcaaatgtatccannnnnnnnncttcttatgtgactttggaaaatatatgttaattatatactaatcacttaccaatgaagt |
223 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3734305 |
gtcaaatgtatccatttttttttcttcttatgcgactttggaaaatatatgttaattatatactaatcacttaccaatgaagt |
3734223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 149
Target Start/End: Complemental strand, 3734096 - 3734048
Alignment:
| Q |
101 |
tggaaaggaagagaagaagaatgatcagacaaattcctcggtcaaatgt |
149 |
Q |
| |
|
||||||||||||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
3734096 |
tggaaaggaagagaagaagaaggatccaacaagttcctcggtcaaatgt |
3734048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 220
Target Start/End: Original strand, 3733938 - 3733972
Alignment:
| Q |
186 |
tatatgttaattatatactaatcacttaccaatga |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3733938 |
tatatgttaattatatacttatcacttaccaatga |
3733972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University