View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_high_33 (Length: 216)
Name: NF5240_high_33
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 3 - 203
Target Start/End: Complemental strand, 40325585 - 40325385
Alignment:
| Q |
3 |
catcattcgtcaattgcctatgtttttcttgtcttgacaattgaccaagttcatccactactgtcatattctccacttcttgtaaaactatttctatttc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |||| |
|
|
| T |
40325585 |
catcattcgtcaattgcctatgtttttcttgtcttgacaattgcccaagttcatccactactgtcatattccccacctcttgtaaaactatttctgtttc |
40325486 |
T |
 |
| Q |
103 |
tcttagccactcaaacacatcatcattcaccctttcggttaaacgatcagttgcttcaannnnnnncttaacatgatctcggtttgaaatcaccttcatc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40325485 |
tcttagccactcaaacacatcatcattcaccctttcggttaaacgatcagttgcttcaatttttttcttaacatgatctcggtttgaaatcaccttcatc |
40325386 |
T |
 |
| Q |
203 |
t |
203 |
Q |
| |
|
| |
|
|
| T |
40325385 |
t |
40325385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University