View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_high_35 (Length: 205)
Name: NF5240_high_35
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 27 - 190
Target Start/End: Original strand, 10338680 - 10338843
Alignment:
| Q |
27 |
tgaggccttggaacatgagaggaagactgtgagagaatctctaatttcggcttatgacaaaaacgtagcaccaaggctaaaagctgaggtttctagcatg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10338680 |
tgaggccttggaacatgagaggaagactgtgagagaatctctaatttcagcttatgacaaaaacatagctccaaggctaaaagccgaggtttctagcatg |
10338779 |
T |
|
| Q |
127 |
gaggtgaacaacttcaacaacatcacaaaagatgcttgcacaagtcagtgttcatgttctatct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10338780 |
gaggtgaacaacttcaacaacatcacaaaagattcttgcacaagtaagtgttcatgttctatct |
10338843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 58 - 190
Target Start/End: Complemental strand, 24208145 - 24208013
Alignment:
| Q |
58 |
agagaatctctaatttcggcttatgacaaaaacgtagcaccaaggctaaaagctgaggtttctagcatggaggtgaacaacttcaacaacatcacaaaag |
157 |
Q |
| |
|
||||||||||| ||||| | || |||||||||| ||| ||||||| || ||||| |||| |||||||||||||||| || ||| |||| || ||||| |
|
|
| T |
24208145 |
agagaatctcttatttctgtttgtgacaaaaacatagttacaaggctgaatgctgatgtttgcagcatggaggtgaacatctacaataacaacagaaaag |
24208046 |
T |
|
| Q |
158 |
atgcttgcacaagtcagtgttcatgttctatct |
190 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||| |
|
|
| T |
24208045 |
atgcttgcactagtaagtgttcatgttctatct |
24208013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University