View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_high_6 (Length: 385)
Name: NF5240_high_6
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 12 - 369
Target Start/End: Original strand, 9495858 - 9496213
Alignment:
| Q |
12 |
atcatcaatttacaagtggttgaatatatgggttccgacgaaaagaagggaacaattcatatatttacagagttttctttcctatagggtttatgtctcc |
111 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9495858 |
atcatcaatttacaagtggttgaatat--gggctccgacgaaaaaaagggaacaattcatatatttacagagttttctctcctatagggtttatgtctcc |
9495955 |
T |
 |
| Q |
112 |
atttttaaggatctatggtggttatcctagaattaccaatgtgatcaactccctttattgattggttcaagtacggttcaaatttaacaattttcttttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9495956 |
atttttaaggatctatggtggttatcctagaattaccaatgtgaacaactccctttattgattggttcaagtacggttcaaatttaacaattttcttttt |
9496055 |
T |
 |
| Q |
212 |
tatctaaggtgctttggcttgatgttaacaacctctatagaaaataggattacttcctttaggattgaaaaaatgagtgtcattggttagaattgcttcg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9496056 |
----taaggtgctttggcttgatgttaacaacctctatagaaaataggattacttcctttaggattgaaaaaatgagtgtcattggttagaactgcttcg |
9496151 |
T |
 |
| Q |
312 |
gattcggtaac----tcgagcgcagttcctaatataaaatacctcgtccgacactttaatat |
369 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496152 |
ggttcggtaactcgatcgagcgcagttcctaatataaaatacctcgtccgacactttaatat |
9496213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University