View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_low_18 (Length: 263)
Name: NF5240_low_18
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 38557519 - 38557768
Alignment:
| Q |
1 |
atcattaagagcgccttcagcttttgtggtcgacgcttggggattgttttcgctaccaaatgaaagttgtccccattttcttatgatctaaagacataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38557519 |
atcattaagagcgccttcagcttttgtggtcgacgcttggggattgttttcgctaccaaatgaaagttgtccccattttcttatgatctaaagacataat |
38557618 |
T |
|
| Q |
101 |
aaggcccatgaagtagaccctcacttcttatataaataaagatgatagtttgcctaatcaaaggtatctcttatttcactgctcatttaactatattatg |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38557619 |
aaggcccatgaagtagactctcacttcttatataaataaagatgatagtttgcctaatcaaaggtatctcttatttcactgctcatttaactatattatg |
38557718 |
T |
|
| Q |
201 |
cagcataatttatgcttagactgactttgcattcggagtaacttttgatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38557719 |
cagcataatttatgcttagactgactttgcattcggagtaacttttgatg |
38557768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University