View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5240_low_24 (Length: 240)

Name: NF5240_low_24
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5240_low_24
NF5240_low_24
[»] chr7 (1 HSPs)
chr7 (23-221)||(38557216-38557414)


Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 23 - 221
Target Start/End: Complemental strand, 38557414 - 38557216
Alignment:
23 tacaggagcttatagtaagtttagtaaaaacatggtggaaatttaaggctttcaaaagatctttactaatcactgaattgacaaaaacctgttatctctt 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38557414 tacaggagcttatagtaagtttagtaaaaacatggtggaaatttaaggctttcaaaagatctttactaatcactgaattgacaaaaacctgttatctctt 38557315  T
123 actgccaaatggccagagtttttgagcagaattcccagctgcaaaattatgcaggctaaacaacgcagtccacccaaatccaatgctcacaattccagc 221  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
38557314 acggccaaatggccagagtttttgagcagaattcccagctgcaaaattatgcaggctaaacaacgcagtccacccaaatccaatgctcacaactccagc 38557216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University