View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_low_30 (Length: 227)
Name: NF5240_low_30
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_low_30 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 43878996 - 43879189
Alignment:
| Q |
18 |
aaattagtccagaaaatggagtgaaagagaaaaaagacaaagggaataagaagaatgattcatgtgttaatgaattggcattgaagatgaaggaattgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43878996 |
aaattagtccagaaaatggagtgaaagagaaaaaagacaaagggaataagaagaatgattcatgtgttaatgaattggcattgaagatgaaggaattgga |
43879095 |
T |
|
| Q |
118 |
gatgaatgattcaggtgatgttgaacaagtactagatatagaagaagcacttcactattattctcgtctcaagagtcctatttatttagatatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43879096 |
gatgaatgattcaggtgatgttgaacaagtactagatatagaagaagcacttcactattattctcgtctcaagagtcctatttatttagatatt |
43879189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 100 - 211
Target Start/End: Complemental strand, 7701 - 7590
Alignment:
| Q |
100 |
gaagatgaaggaattggagatgaatgattcaggtgatgttgaacaagtactagatatagaagaagcacttcactattattctcgtctcaagagtcctatt |
199 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||| ||||||| |||||||| || ||||||||||||||||| |||||||| || || ||||| || |
|
|
| T |
7701 |
gaagatgaaggaattagatatgatggattcaggtgatcttgaacacgtactagacatcgaagaagcacttcactactattctcgccttaaaagtccggtt |
7602 |
T |
|
| Q |
200 |
tatttagatatt |
211 |
Q |
| |
|
||| |||||||| |
|
|
| T |
7601 |
tatctagatatt |
7590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 100 - 183
Target Start/End: Complemental strand, 13285 - 13202
Alignment:
| Q |
100 |
gaagatgaaggaattggagatgaatgattcaggtgatgttgaacaagtactagatatagaagaagcacttcactattattctcg |
183 |
Q |
| |
|
|||||||||| || |||| |||| || ||||||||| ||||||| || ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
13285 |
gaagatgaagaaaatggatatgatggaatcaggtgatcttgaacatgtgctagacatagaagaagcacttcactactattctcg |
13202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University