View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5240_low_9 (Length: 358)
Name: NF5240_low_9
Description: NF5240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5240_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 272
Target Start/End: Complemental strand, 17145605 - 17145358
Alignment:
| Q |
19 |
aatgggggactgatcctttgtttttaggatcatacagttatgttcaagttggttcaagtggtgaagatttagatacaatggctgaaccattaccaatgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17145605 |
aatgggggactgatcctttgtttttaggatcatacagttatgttcaagttggttcaagtggtgaagatttagatacaatggctgaaccattaccaatgat |
17145506 |
T |
 |
| Q |
119 |
gaaagataaagataatagcaatttttcatatccacttcaaattttgtttgcaggtgaagcaactcacagaactcattattcaacaactcatggagcttac |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17145505 |
gaaagataa------tagcaatttttcatatccacttcaaattttgtttgcaggtgaagcaactcacagaactcattattcaacaactcatggagcttac |
17145412 |
T |
 |
| Q |
219 |
ttcagtggtcttagggaagctaataggcttcttcaacattatcattgtgttggg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17145411 |
ttcagtggtcttagggaagctaataggcttcttcaacattatcattgtgttggg |
17145358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University