View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5241_high_12 (Length: 309)
Name: NF5241_high_12
Description: NF5241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5241_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 2 - 299
Target Start/End: Complemental strand, 42468296 - 42468007
Alignment:
| Q |
2 |
aataaaagtgtgactctttgttgttttccacatatctagtaattgttggcttctgttgttaattacgtaagctagctacatattgatccgcatcacgcag |
101 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
42468296 |
aataaaagtgtgactccttgttgttttccacata-------attgttggcttctgttgttaattatgtaagctagctacatattgacctgcatcacgcag |
42468204 |
T |
 |
| Q |
102 |
gatgaaaataatataagcttcgttatgtatttcatccctacaaatatattgttactagtcaatatgtcttttccattaataatgagtgtatacttattga |
201 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42468203 |
gatgaaaataatataagcttcattatgtatttcatccctacaaatatattg-tactagtcaatatgtcttttccattaataatgagtgtatgcttattga |
42468105 |
T |
 |
| Q |
202 |
gctattacttgctcagatgtgtcgaagttttctggtcnnnnnnnnctcttggataaaagattcaacatttactgatagaaaactcgctataagaataa |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42468104 |
gctattacttgctcagatgtgtcgaagttttctggtcttttttctctcttggataaaagattcaacatttactgatagaaaactcgctataagaataa |
42468007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University