View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5241_high_13 (Length: 301)
Name: NF5241_high_13
Description: NF5241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5241_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 78 - 213
Target Start/End: Complemental strand, 51005940 - 51005805
Alignment:
| Q |
78 |
atggcaatgagttcacaaatgtaggctatattttcagttatttgatgtagttatttataggagtagaggttgtcttttccatgaagaaatttgtaattca |
177 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51005940 |
atggcaatgagttcataaatgttggctatattttcagttatttgatgtagttatttataggagtagaggttgtcttttccatgaagaaatttgtaattca |
51005841 |
T |
|
| Q |
178 |
ttcaaggaagtataggcatatattctctgcttttag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51005840 |
ttcaaggaagtataggcatatattctctgcttttag |
51005805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 207 - 301
Target Start/End: Complemental strand, 51005771 - 51005674
Alignment:
| Q |
207 |
cttttaggaatttatctcctatatt---gtatgttaaaatttggattgatttatcgcttatggatattctttgcttcaaattgtatataggaagaaaa |
301 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51005771 |
cttttaggaatttatctcctatattattgtatgttaaaatttggattgatttatcgcttatggatattctttgcttcaaattgtatataggaagaaaa |
51005674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 53
Target Start/End: Complemental strand, 51005965 - 51005936
Alignment:
| Q |
24 |
gaacaaaccttcatctttggtatccatggc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51005965 |
gaacaaaccttcatctttggtatccatggc |
51005936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 28 - 194
Target Start/End: Original strand, 38741696 - 38741859
Alignment:
| Q |
28 |
aaaccttcatctttggtatccatggctagatgtatatgtaattattatgtatggcaatgagttcacaaatgtaggctatatttt-cagttatttgatgta |
126 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||| ||||||||| |||||| |||||||| |
|
|
| T |
38741696 |
aaaccatcatctttggtatccatggctagatgtatatgtagttat---gtatg-caatgagttcacaaatgtagcctatatttttcagttaattgatgta |
38741791 |
T |
|
| Q |
127 |
gttatttataggagtagaggttgtcttttccatgaagaaatttgtaattcattcaaggaagtataggc |
194 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38741792 |
gttatttataggagtagaggttatcttttccatgaagaaatttgtagttcattcaaggaagtataggc |
38741859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University