View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5241_high_5 (Length: 370)
Name: NF5241_high_5
Description: NF5241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5241_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 138 - 367
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
138 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatatatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
 |
| Q |
238 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
 |
| Q |
338 |
gtttggtagtttcaactttcaagttgagat |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 38179523 - 38179595
Alignment:
| Q |
31 |
ccacacatcttcaattaactttgcattagtggtttgatctgtccactgaggaaatgcaaccataggaacccct |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38179523 |
ccacacatcttcaattaactttgcattagtggtttgatctgtccactgaggaaatgcaaccataggaacccct |
38179595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 38169709 - 38169781
Alignment:
| Q |
31 |
ccacacatcttcaattaactttgcattagtggtttgatctgtccactgaggaaatgcaaccataggaacccct |
103 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38169709 |
ccacacatcttcaattaacttcgcattagtggtttgatctgtccactgaggaaatgcaaccataggaacccct |
38169781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 38184192 - 38184264
Alignment:
| Q |
31 |
ccacacatcttcaattaactttgcattagtggtttgatctgtccactgaggaaatgcaaccataggaacccct |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
38184192 |
ccacaaatcttcaattaactttgcattagtagtttgatctgtccactggggaaatgctaccataggaacccct |
38184264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 103
Target Start/End: Complemental strand, 35054235 - 35054163
Alignment:
| Q |
31 |
ccacacatcttcaattaactttgcattagtggtttgatctgtccactgaggaaatgcaaccataggaacccct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||| || ||||| || ||||||||||||||| |
|
|
| T |
35054235 |
ccacacatcttcaattaactttgcattagtcatctgatctgtccattgtggaaacgccaccataggaacccct |
35054163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 35060973 - 35060917
Alignment:
| Q |
31 |
ccacacatcttcaattaactttgcattagtggtttgatctgtccactgaggaaatgc |
87 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| ||||| ||||||||||| |
|
|
| T |
35060973 |
ccacacatcttcaattagttttgcattagtcttttgatcagtccattgaggaaatgc |
35060917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University