View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5241_high_8 (Length: 319)
Name: NF5241_high_8
Description: NF5241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5241_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 1004743 - 1004435
Alignment:
| Q |
1 |
acattttcatattgctgatctctggaaaaaggacccaatgtaccatgggtttgttgattccattttcccaaaattggaggacacatcttgaagccatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004743 |
acattttcatattgctgatctctggaaaaaggacccaatgtaccatgggtttattgattccattttcccaaaattggaggacacatcttgaagccatttt |
1004644 |
T |
|
| Q |
101 |
gtttagaggctttgtactgtaagcctgcaaatcgtttgtcttattttcctattggtaaagcgaaattgaaccagatccttgatcctttcatcttaacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004643 |
gtttagaggctttgtactgtaagcctgcaaatcgtttgtcttattttcctattggtaaagcgaaattgaaccagatccttgatcctttcatcttaacttt |
1004544 |
T |
|
| Q |
201 |
atgctttagagtttagactattgttcgttttaatacacagacagctacttcaaagtatttgtctcccaggatgctgttaatgatataccagtcttggtca |
300 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1004543 |
atgctttagagtttagactattgttcattttaatacacagacagctacttcaaagtatttgtctcccaggatgctgttaatgatattccagtcttggtca |
1004444 |
T |
|
| Q |
301 |
caatctgtg |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
1004443 |
caatctgtg |
1004435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 2 - 95
Target Start/End: Complemental strand, 995897 - 995804
Alignment:
| Q |
2 |
cattttcatattgctgatctctggaaaaaggacccaatgtaccatgggtttgttgattccattttcccaaaattggaggacacatcttgaagcc |
95 |
Q |
| |
|
||||||||| ||||| |||||||||| ||||||||||||||| |||| ||| |||||||||||||||||| ||| ||| |||||| ||||||| |
|
|
| T |
995897 |
cattttcatcttgctaatctctggaagaaggacccaatgtacaatggttttcttgattccattttcccaacattacaggccacatcatgaagcc |
995804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University