View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5242-Insertion-6 (Length: 199)
Name: NF5242-Insertion-6
Description: NF5242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5242-Insertion-6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 7e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 44333177 - 44333369
Alignment:
| Q |
12 |
taaaattaaaatttgatttattatcaaatatttatactacatcctcaaatttgcattgg-----tgtacttcacaactgtacgagaataaaaattagcct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
44333177 |
taaaattaaaatttgatttattatcaaatatttatactacatcctcaaatttgcattggtatactatacttcacaactgtacgagaataaaaattagcct |
44333276 |
T |
 |
| Q |
107 |
acttcgttggatggttgtttgttcccaatcatgtatgctttcctctcttctatgaatcaatattgtttataccaacagaattaaattttgaac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333277 |
acttcgttggatggttgtttgttcccaatcatgtatgctttcctctcttctatgaatcaatattgtttataccaacagaattaaattttgaac |
44333369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University