View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5242-Insertion-9 (Length: 119)
Name: NF5242-Insertion-9
Description: NF5242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5242-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 5 - 119
Target Start/End: Original strand, 43338072 - 43338187
Alignment:
| Q |
5 |
acaacaataacca-tcaaattagcaagtcgaggatgacgcaatttgccaacaccagaggcttcttcaacaaactgttttggatccggccaagtagctttc |
103 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43338072 |
acaacaataaccaatcaaattagcaagtcgaggatgacgcaatttgccaacaccagaagcttcttcaacaaactgttttggatccggccaagcagcttta |
43338171 |
T |
 |
| Q |
104 |
ccgaacttcttcacag |
119 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43338172 |
ccgaacttcttcacag |
43338187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University