View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5242_low_4 (Length: 260)

Name: NF5242_low_4
Description: NF5242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5242_low_4
NF5242_low_4
[»] chr7 (1 HSPs)
chr7 (1-245)||(40383916-40384160)
[»] chr1 (1 HSPs)
chr1 (40-243)||(52374995-52375198)


Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 40383916 - 40384160
Alignment:
1 atcgtggatgatgtctgtgccgatggagacacggcggcgttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcagcgttgcgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40383916 atcgtggatgatgtctgtgccgatggagacacggcggcgttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcagcgttgcgg 40384015  T
101 agaccgagctggtcgatgagtgcttggacacgagcttttttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgagagtttctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40384016 agaccgagctggtcgatgagtgcttggacacgagcttttttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgagagtttctt 40384115  T
201 ccacggtgagcatggggaagagaagatcgtcttgcatgacataag 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
40384116 ccacggtgagcatggggaagagaagatcgtcttgcatgacataag 40384160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 40 - 243
Target Start/End: Complemental strand, 52375198 - 52374995
Alignment:
40 ttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcagcgttgcggagaccgagctggtcgatgagtgcttggacacgagctttt 139  Q
    ||||||||| || || |||||||||||||| |||||||| || |||   || ||||||||||| || || || || || |  ||||| |||||||| |||    
52375198 ttctccaccagagactccacggtgaccttcgtctccgataactgttttcgctgcgttgcggagtcctagttgatcaatcaaagcttgaacacgagcgttt 52375099  T
140 ttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgagagtttcttccacggtgagcatggggaagagaagatcgtcttgcatga 239  Q
    ||||||||||| ||||| || || || |  || || ||||| |  ||  ||||||||||||| || |||||||| || ||||| ||||| |||||||| |    
52375098 ttctttgattttgagagtgatcgcggtaatcggaattcagctgcaaaggtgagagtttcttcaactgtgagcattggaaagaggagatcatcttgcatca 52374999  T
240 cata 243  Q
    ||||    
52374998 cata 52374995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University