View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243-Insertion-13 (Length: 186)
Name: NF5243-Insertion-13
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243-Insertion-13 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 6 - 186
Target Start/End: Complemental strand, 431487 - 431307
Alignment:
| Q |
6 |
cactaacaaattcacccttatctggaagagacttttcaccagaaacaataataggttctctatctttggtcagagatgaatcgacattttccatacagca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
431487 |
cactaacaaattcacccttatctggaagagatttttcaccagaaacaataataggttctctatctttggtcagagatgaatcgacattttccatacagca |
431388 |
T |
 |
| Q |
106 |
ttctgacaatttttccggaatgtctgcatatttagatgagagaatttcagatgaacccgacatatcaacagattgcgcaat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
431387 |
ttctgacaatttttccggaatgtctgcatatttagatgagagaatttcagatgaacccaacatatcaacagattgcgcaat |
431307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University