View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243-Insertion-14 (Length: 122)
Name: NF5243-Insertion-14
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243-Insertion-14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 3e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 7 - 122
Target Start/End: Complemental strand, 32789861 - 32789741
Alignment:
| Q |
7 |
ataaagtagcagccctttgtgaaagggataccattagaggagagtc---tcctattttcattctttaaataaaac--nnnnnnnncttttcatttctttc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32789861 |
ataaagtagcagccctttgtgaaagggataccattagaggagagtctcctcctattttcattctttaaataaaacttttttttttcttttcatttctttc |
32789762 |
T |
 |
| Q |
102 |
tattgattctccatccattgt |
122 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32789761 |
tattgattctccatccattgt |
32789741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University