View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243-Insertion-3 (Length: 433)
Name: NF5243-Insertion-3
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243-Insertion-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 334
Target Start/End: Complemental strand, 39088517 - 39088201
Alignment:
| Q |
18 |
atatagatagagatgggaaggtgagtggggatccattttcatttatcacaacaatatcccaacgnnnnnnnnnntcagactaaagatgttgccttgatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39088517 |
atatagatagagatgggaaggtgagtggggatccattttcatttatcacaacaatatcccaacgaaaaaaaaaatcagactaaagatgttgccttgatgg |
39088418 |
T |
|
| Q |
118 |
tctaagcagtgacctcactcaaattaagatgggacaaaacgttaatttcaaatatatgtataccctgcaagaccaaagttggcatgacttgttcattcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088417 |
tctaagcagtgacctcactcaaattaagatgggacaaaacgttaatttcaaatatatgtataccctgcaagaccaaagttggcatgacttgttcattcaa |
39088318 |
T |
|
| Q |
218 |
gtaatacctcatttgcttnnnnnnnncatgtcacgtttgcatttctcactatttcaaaataattatcacgttaaaatatcaagacannnnnnnnaggggg |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39088317 |
gtaatacctcatttgcttaaaacaaacatgtcacgtttgcatttctcactatttcaaaataattatcacgttaaaatatcaagacattttttttaggggg |
39088218 |
T |
|
| Q |
318 |
gtttgatatatcaaaac |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39088217 |
gtttgatatatcaaaac |
39088201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 388 - 431
Target Start/End: Complemental strand, 39088147 - 39088104
Alignment:
| Q |
388 |
gacaacctaaaataattgtcaatgtgcacaccgtatctacaaat |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39088147 |
gacaacctaaaataattgtcaatgtgcacaccgtatctgcaaat |
39088104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 271 - 299
Target Start/End: Original strand, 3098417 - 3098445
Alignment:
| Q |
271 |
tcaaaataattatcacgttaaaatatcaa |
299 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3098417 |
tcaaaataattatcacgttaaaatatcaa |
3098445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University