View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243-Insertion-8 (Length: 531)
Name: NF5243-Insertion-8
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243-Insertion-8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 35239771 - 35239926
Alignment:
| Q |
8 |
gtccaggagcccaactttttggttgatccaacaagcacaacatggtcaccgaattgaacttggtgatctaatcgaagatgtagatgaacattaatgtttt |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35239771 |
gtccaggagcccaactgtttggttgatccaagaagcacaacatggtcaccgaattgaacttggtgatctaatcgaagatgtagatgaacattaatgtctt |
35239870 |
T |
|
| Q |
108 |
c------tttgttgtaggtattgttcctttttccacatgaatcgagtatagtgagt |
157 |
Q |
| |
|
| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35239871 |
cttcttttttgttgttggtattgttcctttttccacatgaatcgagtatagtgagt |
35239926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 322 - 459
Target Start/End: Original strand, 35240112 - 35240246
Alignment:
| Q |
322 |
tcctcttggctgattatggttccaattccgattcgaattcgaattccttctgggactgggaggatggatgatggtgtaagtacagtggcagtgcagagaa |
421 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||| |
|
|
| T |
35240112 |
tcctcttggctgattatggttccgattccgattcggattcgaattccttctgggactgggaggatggatgatggtgtaagtacagtgacggtgaagag-- |
35240209 |
T |
|
| Q |
422 |
taataataattcatcgccactcaactgaacggtggtgt |
459 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35240210 |
-aataataattcatcgccactcaactgaacggtggtgt |
35240246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 205 - 262
Target Start/End: Original strand, 35239989 - 35240046
Alignment:
| Q |
205 |
gatacgatacctaggttgggtttgggtggaagaggaggcagcaacagacacgagacgg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35239989 |
gatacgatacctaggttgggtttgggtggaagaggaggcagcaacagacacgagacgg |
35240046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University