View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_high_28 (Length: 235)
Name: NF5243_high_28
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 53 - 219
Target Start/End: Original strand, 43172356 - 43172522
Alignment:
| Q |
53 |
ctgttttcattggtgaaatctctcaattatggcctcaacttcctcttcttgcaaaccttcgttgtggcctttggtactcttccaatttccattccacttg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43172356 |
ctgttttcattggtgaaatctctcaattatggcctcaacttcctcttcttgcaaaccttcgttgtggcctttggtactcttccaatttccattccacttg |
43172455 |
T |
 |
| Q |
153 |
ttacttcaaatccacagatggtcacaccaacaattgttctttctccacttctcgtctcaaccttcat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43172456 |
ttacttcaaatccacagatggtcacaccaacaattgttctttctccacttctcgtctcaaccttcat |
43172522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University