View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_high_31 (Length: 221)
Name: NF5243_high_31
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 53 - 205
Target Start/End: Original strand, 2964641 - 2964793
Alignment:
| Q |
53 |
tttaacactcatcaagaacatgcagagttttttcaaaaggaacatgcagagttgtaaacaaaatttagggaaagtaagtgcaacaaaggataaaattaac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2964641 |
tttaacactcatcaagaacatgcagagttttttcaaaaggaacatgcagagttgtaaacaaaatttagggaaagtaagtgcaacaaaggataaaattaac |
2964740 |
T |
 |
| Q |
153 |
caaacaacaatgtcaaaagcatttagggacaaatttttaaaacatgtgatatt |
205 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| ||||||||||||| |
|
|
| T |
2964741 |
caaacaacaatgtcaatagaatttagggacaaatttttataacatgtgatatt |
2964793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 53 - 82
Target Start/End: Original strand, 2945317 - 2945346
Alignment:
| Q |
53 |
tttaacactcatcaagaacatgcagagttt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2945317 |
tttaacactcatcaagaacatgcagagttt |
2945346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University