View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_high_34 (Length: 205)
Name: NF5243_high_34
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 5 - 195
Target Start/End: Original strand, 29557866 - 29558056
Alignment:
| Q |
5 |
ttgattagtggtctgtgtttgcttatttgtttaattattgtatttaattatttcaggggattgggaagttgtcattggttgctgcttccgctgctaatgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29557866 |
ttgattagtggtctgtgtttgcttatttgtttaattattgtatttaattatttcaggggattgggaagttgtcattggttgctgcttccgctgctaatgc |
29557965 |
T |
 |
| Q |
105 |
tgttcagactggcacaaaagagattacttctaaggtatttggattattttgttcatggggtgagatgattgttattgatattttgatgatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29557966 |
tgttcagactggcacaaaagagattacttctaaggtatttggattattttgttcatggggtgagatgattgttattgatattttgatgatg |
29558056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University