View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_low_12 (Length: 325)
Name: NF5243_low_12
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 54 - 308
Target Start/End: Original strand, 37301953 - 37302207
Alignment:
| Q |
54 |
tacattattttcttacaacaatatcatagattcgaagtacaatcatttatcaataataactaatactcaacgataattttttgcacacacaatatagtta |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37301953 |
tacattattttcttacaacaatatcatagattcgaagtacaatcatttattaataataactaatactcagcgataattttttgcacacacaatatagtta |
37302052 |
T |
|
| Q |
154 |
tctcttgaagagtgacccttattttagatgctcaaattctaataactcgaatgaactaaatatatttgtaaatacgttttagtacttgaaattgagtata |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| || |
|
|
| T |
37302053 |
tctcttgaagagtgacccttattttagatgctcaaattctaataactcgaatgaactaaatatatttgcaaatacgttttagtacttgacattgagtgta |
37302152 |
T |
|
| Q |
254 |
taacattaaaaatcaaagcaatgatttgaacatctttaatgtttcaacacttttt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37302153 |
taacattaaaaatcaaagcaatgatttgaacatctttaacgtttcaacacttttt |
37302207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 40
Target Start/End: Original strand, 37301915 - 37301943
Alignment:
| Q |
12 |
tatacttaggaatacattgttgaattaat |
40 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37301915 |
tatacttaggaatacattgttgaattaat |
37301943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University