View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_low_14 (Length: 306)
Name: NF5243_low_14
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 42667410 - 42667614
Alignment:
| Q |
1 |
ttcaacgcttttatgtctatgcttcttctttcctttcaaagattgttgcattttctcatccttcgttacaattaactttttattctttctctctgcagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667410 |
ttcaacgcttttatgtctatgcttcttctttcctttcaaagattgttgcattttctcatccttcgttacaattaactttttattctttctctctgcagca |
42667509 |
T |
 |
| Q |
101 |
gtgttattttttgttttctcaatcttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgtacttcaatgtcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667510 |
gtgttattttttgttttctcaatcttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgtacttcaatgtcct |
42667609 |
T |
 |
| Q |
201 |
tgatg |
205 |
Q |
| |
|
||||| |
|
|
| T |
42667610 |
tgatg |
42667614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 233 - 299
Target Start/End: Original strand, 42667642 - 42667708
Alignment:
| Q |
233 |
aagtttaagtccaatccacgataacggttaacatgagtatcatcgctaaatcgccactgttcatctc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667642 |
aagtttaagtccaatccacgataacggttaacatgagtatcatcgctaaatcgccactgttcatctc |
42667708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University