View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_low_18 (Length: 264)
Name: NF5243_low_18
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 26881097 - 26881250
Alignment:
| Q |
1 |
ggactcaccaaaatgaagttgttcccaaggccatgatgcttagagaaatggtgaaagccggtctccttttggtggaggaggttgttttaataggagttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26881097 |
ggactcaccaaaatgaagttgttcccaaggccatgatacttagagaaatggtgaaagccggtctccttttggtcgaggaggttgttttaataggagttta |
26881196 |
T |
|
| Q |
101 |
tgttccaatcgaggaagcaaccaggcgggaattagggaacaagagaagaacaca |
154 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
26881197 |
tgttctaatcgaggaagcaacgaggcgggaattacggaacaagagaagaacaca |
26881250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 209 - 243
Target Start/End: Original strand, 26881255 - 26881289
Alignment:
| Q |
209 |
taggttataaattgtaaaactaatcaagatgcaag |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881255 |
taggttataaattgtaaaactaatcaagatgcaag |
26881289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University