View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_low_19 (Length: 251)
Name: NF5243_low_19
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 49957521 - 49957280
Alignment:
| Q |
10 |
aagaatattcccttcaggactccatgatacacgggtgacggatatagatgcatccttcacaattgcagcctacacaagagttccagttatatgacttgta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49957521 |
aagaatattcccttcaggactccatgatacacgggtgacggatatagatgcatccttcacaattgcagcctacacaagagttccagttatatgacttgta |
49957422 |
T |
 |
| Q |
110 |
taagataattttgccacttgctacatttatttagatttcaacaaaacagcactagcatactacatttatttagatttctacaaaaataacactagaatcg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49957421 |
taagataattttgccacttgctacatttatttagatttcaacaaaacagcactagcatactacatttatttagatttctacaaaaataacactagcatcg |
49957322 |
T |
 |
| Q |
210 |
caaataacccttattccataatattcaattgtatccctttat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49957321 |
caaataacccttattccataatattcaattgtatccctttat |
49957280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University