View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_low_23 (Length: 241)
Name: NF5243_low_23
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_low_23 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 431481 - 431703
Alignment:
| Q |
19 |
gttagtggtacggtcgaagtgtcacaaaaaatgtatccaaagtcagaagctgatgctgacaacgatgttagtgttgctgaagatggggatcataaatgtt |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
431481 |
gttagtggtacggccgaagtgtcacaaaaaatgtatccaaagtcagaagctgatgctgacaacgatgttagtgttgctgaagatggggatcataaatgtt |
431580 |
T |
 |
| Q |
119 |
cagcccctgatgggctgcatgagaaggctgaggagcaggatgaagtacttgggatatctgtacctcaaccagaagatgagagtgatgaatcagattttgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
431581 |
cagcccctgatgggctgcatgagaaggctgaggagcaggatgaagtacttgggatatctgtacctcaaccagaagatgagagtgatgaatcagattttgt |
431680 |
T |
 |
| Q |
219 |
tgagcatgatgtaagtacatttt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
431681 |
tgagcatgatgtaagtacatttt |
431703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University