View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5243_low_8 (Length: 350)
Name: NF5243_low_8
Description: NF5243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5243_low_8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 9e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 194 - 350
Target Start/End: Complemental strand, 7640312 - 7640158
Alignment:
| Q |
194 |
gcagttgatcttgctttatcctctaaaagacaaatggannnnnnnatcaaactacacaaacatttcctacacttcatatgcatgcttaaaaatatacact |
293 |
Q |
| |
|
|||||| |||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7640312 |
gcagtttatcttgctttatcctctaaatggcaaatggatttttttctcaaactacacaaacatttcctacacttcatatgcatgcttaaaaatatacact |
7640213 |
T |
|
| Q |
294 |
tctacaaacttcaagcttattttctataaaatctcactacatggtaaagaattcgac |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7640212 |
tctacaaacttcaagcttattttctataaaatctcactacatgg--aagaattcgac |
7640158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University