View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5244_low_4 (Length: 237)
Name: NF5244_low_4
Description: NF5244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5244_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 43 - 235
Target Start/End: Complemental strand, 50464802 - 50464611
Alignment:
| Q |
43 |
tatgccctcacgaggtcaaacacatatgacaataataaatgcattttaccggttatgttttgttttcttcatgctaacctagttgattcaaattgatcta |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50464802 |
tatgccctcacgaggtcaaacacatatgacaataataaatgcattttaccggttatgttttgttttcttcatgctaacctagttgattcaaattgatcta |
50464703 |
T |
|
| Q |
143 |
gtagggtaatcaagtattgcactcaaattattaataagctctctcaaaaatgaattgaatttgttatttaccattgaaccgaactctagatta |
235 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
50464702 |
gta-ggtaatcaagtattgcactcaaatcgttaataagctctctcaaaaatgaattgaattcattatttaccattcaaccgaactctagatta |
50464611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University