View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5245-Insertion-10 (Length: 350)
Name: NF5245-Insertion-10
Description: NF5245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5245-Insertion-10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 247
Target Start/End: Original strand, 23040079 - 23040317
Alignment:
| Q |
9 |
catcagccatgaacaacgttgctgtcactctcaagtcatagtggcacgaagcacatatacttattagtataattattaatgcaaagaccatattgg---g |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
23040079 |
catcagccatgaacaacgttgctgtcactctcaagtcatagtggcaagaagcacatatacttattagtataatta---atgcaaagaccatattggccgg |
23040175 |
T |
 |
| Q |
106 |
ttgacattgaaattaaaattgacttgctaggcatatcaattttatggttttagttgttgatcattgactgtaacaataataaagtagtttctgatcacat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23040176 |
ttgacattgaaattaaaattgacttgctaggcatatcaattttatggttttagttgttgatcattgactgtaacaataataaagaagtttctgatcacat |
23040275 |
T |
 |
| Q |
206 |
taacatatcggtttaatgccgctatatatggccatgattact |
247 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23040276 |
taacatatcggtttaatgccactatatatggccatgattact |
23040317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 328
Target Start/End: Original strand, 23040337 - 23040382
Alignment:
| Q |
283 |
actataggacttcaataccacaaacgttggagttttctaaactcta |
328 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23040337 |
actataggacttcaataccacaaactttggagttttctaaactcta |
23040382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University