View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5245-Insertion-11 (Length: 323)
Name: NF5245-Insertion-11
Description: NF5245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5245-Insertion-11 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 128 - 323
Target Start/End: Complemental strand, 42227095 - 42226901
Alignment:
| Q |
128 |
cattagcttcctccctgaaccttccgccatatagtatctacataaattaattaacatgagtttatagtttcgatcaaaacaaagattttgtgttaagatt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227095 |
cattagcttcctccctgaaccttccgccatatagtatctacataaattaattaacatgagtttatagtttcgatcaaaacaaagattttgtgttaagatt |
42226996 |
T |
 |
| Q |
228 |
tcgccacctttgataaatttgtcaggttatgtctcttgatccttgactgatgtgtatggacaaatatttgttcgaatacctctcgttatatgcgtg |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42226995 |
tcgccacctttgataaatttgtcaggttatgtctcttgatccttgactgatgtgtatggacaaatatttgttcgaatacctct-gttatatgcgtg |
42226901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 7 - 60
Target Start/End: Complemental strand, 42227119 - 42227066
Alignment:
| Q |
7 |
atgatttgcattgatgatttctaccattagcttcctccctgaaccttccgccat |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227119 |
atgatttgcattgatgatttctaccattagcttcctccctgaaccttccgccat |
42227066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University