View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5245_high_15 (Length: 215)

Name: NF5245_high_15
Description: NF5245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5245_high_15
NF5245_high_15
[»] chr8 (1 HSPs)
chr8 (92-130)||(44969490-44969528)
[»] chr5 (1 HSPs)
chr5 (92-130)||(35331259-35331297)


Alignment Details
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 130
Target Start/End: Complemental strand, 44969528 - 44969490
Alignment:
92 tgatcttattgatatatacgtaacaggtttgtgtacatc 130  Q
    |||||||||||||||||||||||||||||||||||||||    
44969528 tgatcttattgatatatacgtaacaggtttgtgtacatc 44969490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 130
Target Start/End: Complemental strand, 35331297 - 35331259
Alignment:
92 tgatcttattgatatatacgtaacaggtttgtgtacatc 130  Q
    |||||||||||||||||||||||||||||||||||||||    
35331297 tgatcttattgatatatacgtaacaggtttgtgtacatc 35331259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University