View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5245_low_15 (Length: 215)
Name: NF5245_low_15
Description: NF5245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5245_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 130
Target Start/End: Complemental strand, 44969528 - 44969490
Alignment:
| Q |
92 |
tgatcttattgatatatacgtaacaggtttgtgtacatc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44969528 |
tgatcttattgatatatacgtaacaggtttgtgtacatc |
44969490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 130
Target Start/End: Complemental strand, 35331297 - 35331259
Alignment:
| Q |
92 |
tgatcttattgatatatacgtaacaggtttgtgtacatc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35331297 |
tgatcttattgatatatacgtaacaggtttgtgtacatc |
35331259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University