View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5245_low_6 (Length: 261)
Name: NF5245_low_6
Description: NF5245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5245_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 3045941 - 3046165
Alignment:
| Q |
20 |
tgtactaataagtgaaacatcaataatgtaaccactcttgaagaaaatcaatttcatcttctaacgtttacttattttaggtcaagtaatcgtgtaatgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3045941 |
tgtactaataagtgaaacatcaataatgtaaccactcttgaagaaaatcaatttcatcttctaacgtttacttattttaggtcaagtaattgtgtaatgg |
3046040 |
T |
 |
| Q |
120 |
ttaaaaattcatattttaagttggggtgtgcacgatttgaaccctaactcttgtatatatttaacttcttaattagtgctttagatgcacttattagtta |
219 |
Q |
| |
|
||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||| ||||| ||||||| || |
|
|
| T |
3046041 |
ttagaaattcatattttaaggtggggtgtgcacgattcgaaccctaactcttgtatatatttaacttcttaaccagtgccttaaatgcatttattagcta |
3046140 |
T |
 |
| Q |
220 |
actctattatgtaatgttcatatca |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3046141 |
actctattatgtaatgttcatatca |
3046165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University