View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5246_high_14 (Length: 302)
Name: NF5246_high_14
Description: NF5246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5246_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 18 - 289
Target Start/End: Complemental strand, 7044631 - 7044360
Alignment:
| Q |
18 |
tcaaacgcttctcaaatggagcatagatagcttgtgtttcaagtatgacagctgatgtgttgaatatattgcaaaacagattcttccgattaacatcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7044631 |
tcaaacgcttctcaaatggagcatagatagcttgtgtttcaagtatgacagctgatgtgttgaatatattgcaaaacagattcttccgattaacatcaaa |
7044532 |
T |
 |
| Q |
118 |
ggccttgccggaagttttgcaacacttgccaattggttcttttcgtggttgattacattgacagcaaatttgctcttggattggagttctggaggtttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7044531 |
ggccttgccggaagttttgcaacacttgccaattggttcttttcgtggttgattacattgacagcaaatttgctcttggattggagttctggaggtttgt |
7044432 |
T |
 |
| Q |
218 |
gtgcattgtccaagttatatttttctcgaaatatctttgttatttgttgctaaccagaagcttcttttgttc |
289 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7044431 |
gtgcattgtccgagttatatttttctcgaaatatctttgttatttgttgctaaccagaagcttcttttgttc |
7044360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University