View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5246_low_21 (Length: 226)

Name: NF5246_low_21
Description: NF5246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5246_low_21
NF5246_low_21
[»] chr1 (1 HSPs)
chr1 (16-208)||(52807563-52807755)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 52807563 - 52807755
Alignment:
16 cataggttcttcaactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatct 115  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52807563 cataggttcttgaactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatct 52807662  T
116 ctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttc 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52807663 ctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttc 52807755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University