View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5246_low_21 (Length: 226)
Name: NF5246_low_21
Description: NF5246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5246_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 52807563 - 52807755
Alignment:
| Q |
16 |
cataggttcttcaactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatct |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807563 |
cataggttcttgaactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatct |
52807662 |
T |
 |
| Q |
116 |
ctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807663 |
ctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttc |
52807755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University