View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5246_low_8 (Length: 408)
Name: NF5246_low_8
Description: NF5246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5246_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 9e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 32605527 - 32605368
Alignment:
| Q |
18 |
agatgtttgtattggcgaaggcacgaaggatggaagagtttgtgtcgaagattttaatgtgggtgattgtggtttgggttttgaggaaagtggcgacggt |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32605527 |
agatgtttgtattggcgaaggcacggaggatggaagagtttgtgtcgaagattttaatgtgggtgattgtggtttgggttttgaggaaagtggcgacggt |
32605428 |
T |
 |
| Q |
118 |
tgtgggtggtgggaggttgttggcgatggtgccgtagttgacgccgatgttgtaggtggc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32605427 |
tgtgggtggtgggaggttgttggcgatggtgccgtagttgacgccgatgttgtaggtggc |
32605368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 265 - 393
Target Start/End: Complemental strand, 32605280 - 32605152
Alignment:
| Q |
265 |
tggaaactggaaagtgaaatttgagaccattttgattggatcaaaccgccattgtggggtccagtgtggagtcaaactaaacattatttctaggttttgc |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32605280 |
tggaaactggaaagtgaaatttgagaccattttgattggatcaaaccgccattgtggggtccaatgtggagtcaaactaaacattatttctaggttttgc |
32605181 |
T |
 |
| Q |
365 |
gatgtttacgttgtcctcatctagatatt |
393 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32605180 |
gatgtttacgttgtcctcatctagatatt |
32605152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University