View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5246_low_9 (Length: 401)
Name: NF5246_low_9
Description: NF5246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5246_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 1 - 391
Target Start/End: Complemental strand, 12953222 - 12952832
Alignment:
| Q |
1 |
ttgttccggtggtggtggtgatgtggtggcagcgcagtcgaaggtggagggtaagaagaagcagaggaagaaattggaatggtgggcttcacttgatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12953222 |
ttgttccggtggtggtggtgatgtggtggcagcgcagtcgaaggtggagggtaagaagaagcagaggaagaaattggaatggtgggcttcacttgatgag |
12953123 |
T |
|
| Q |
101 |
gagaaagttaaaggaaagaagaataggaaaccaagggaatggtggaaggaggaattttgtgaagagctttcgaagaagagtaggaagaaaaagagaagcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12953122 |
gagaaagttaaaggaaagaagaatagaaaaccaagggaatggtggaaggaggaattttgtgaagagctttcgaagaagagtaggaagaaaaagagaagcc |
12953023 |
T |
|
| Q |
201 |
ttgattgtcgcggcaatggaggggaatcgtggtggcagagagacgaggatgtaggcggcgcagcagtagagaaaaagaaaaagaggaaaagtaagagtag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
12953022 |
ttgattgtcgcggcaatggaggggaatcgtggtggcagagagacaaggatgtaggcggcccaccattagagaagaagaaaaagaggaaaagtaagagtag |
12952923 |
T |
|
| Q |
301 |
tagagggagtattgattggtggttggatggtttaagcggcgagcttaggactaacgcaaggagaaatagtcaagattggggtaatgatgat |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
12952922 |
tagagggagtattgattggtggttggatggtttaagcggcgagcttaggactaacggaaggagaaatagtcaagattggggtaatggtgat |
12952832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University