View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5247_high_27 (Length: 239)
Name: NF5247_high_27
Description: NF5247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5247_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37905753 - 37905531
Alignment:
| Q |
1 |
ctgttcctgttctggtggagattctggagacggccggagattgtgatgctgattcttataagtatgatatggagaaggattgtgcgttcatccttggtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37905753 |
ctgttcctgttctggtggagattctggagacggccggagattgtgatgctgattcttataagtatgatatggagaaggattgtgcgttcatccttggtct |
37905654 |
T |
 |
| Q |
101 |
cctcgctgtcaaagtaattacgttattctttttgaataatatcaattatgtgatgannnnnnnattgattaggtcaagttttgtcttaattttgattcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37905653 |
cctcgctgtcaaagtaattacgttattctttttgaataatatcaattatgtcatgaattttttattgattaggtcaagttttgtcttaattttgattcat |
37905554 |
T |
 |
| Q |
201 |
tgagttaatcaacttttgttcct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37905553 |
tgagttaatcaacttttgttcct |
37905531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37912264 - 37912042
Alignment:
| Q |
1 |
ctgttcctgttctggtggagattctggagacggccggagattgtgatgctgattcttataagtatgatatggagaaggattgtgcgttcatccttggtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37912264 |
ctgttcctgttctggtggagattctggagacggccggagattgtgatgctgattcttataagtatgatatggagaaggattgtgcgttcatccttggtct |
37912165 |
T |
 |
| Q |
101 |
cctcgctgtcaaagtaattacgttattctttttgaataatatcaattatgtgatgannnnnnnattgattaggtcaagttttgtcttaattttgattcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37912164 |
cctcgctgtcaaagtaattacgttattctttttgaataatatcaattatgtcatgaattttttattgattaggtcaagttttgtcttaattttgattcat |
37912065 |
T |
 |
| Q |
201 |
tgagttaatcaacttttgttcct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37912064 |
tgagttaatcaacttttgttcct |
37912042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University